If you are unable to view this email in html format, please click here
 
 
Product & Service Selection Map | Publications |  Promo  
    Simultaneously Profile the Major Small RNA Classes
- miRNA, pre-miRNA, tRNA, tsRNA, and snoRNA

Arraystar Small RNA Array uses direct end-labeling and smart probe design microarray technologies to detect and quantify small RNAs including miRNA, pre-miRNA, tsRNAs, tRNAs, and snoRNAs simultaneously on the same array.
• Overcome biases from RNA modifications, PCR amplifications, and analysis inaccuracy in small RNA-seq
• Require as low as 100 ng total RNA, opening up new opportunities in tsRNA and tRNA biomarker research
• Tolerant lower qualities RNAs, such as degraded RNAs, serum/plasma/biofluid RNAs, and FFPE RNAs
Learn more>>

microRNA:
Mature-ID Mature-Sequence Seed High_Confidence Type
hsa-miR-188-5p CATCCCTTGCATGGTGGAGGG ATCCCTT Yes Mature

tsRNA:
tsRNA_type tsRNA-sequence tsRNA-length tsRNA-precursor Level Molecular mechanism
3'tiRNA ATTCAAAGGTTCCGGGTTCGAGTCCC… 39 tRNA-Arg-TCT-1 Potential Cytotoxicity to neurons

Pre-microRNA:
Precursor-Sequence GenomeLocus Promoter pri-miRNA pre-miRNA-cluster Mature-ID
CGGGGTGAGGTAA… chr22:46113686-46113768:+ p2@MIRLET7BHG, p4@MIR4763 NR_027033 let7a-3,let7b,4763 hsa-let-7b-5p

tRNA:
tRNA-Sequence Gene name GenomeLocus tRNA promoter locus pre-tRNA locus tRNA neighbouring gene
GGGGGTATAGCTC… tRNA-Ala-AGC-1-1 chr6:28795963-28796035:- chr6:28795963-28796135:- chr6:28795952-28796135:- XXbac-BPG308K3.5

snoRNA:
snoRNA-sequence Length Gene name snoDB_symbol Box type Host gene id Host gene symbol Target count Target summary
CCAACATGGATAG… 209 RNU105C RNU105C H/ACA / / 2 Others


Get Quote Now!

Subscribe to Our Newsletters!



Selected Publications

• Circular RNA Array
   [PMID: 37004067] Zhong GL, et al.
   (2023) Molecular Cancer

• m6A Single Nucleotide Array
   [PMID: 36631441] Yan W, et al.
   (2023) International Journal of Oral
   Science

• tRNA PCR Array
   [PMID: 37283053] Wang C, et al.
   (2023) Nucleic Acids Research

• LC-MS Based tRNA Modification
   [PMID: 37563288] Li G, et al.
   (2023) Nature Microbiology


New Service

DRIPc-Seq
provides valuable functional insights in transcriptional regulation by LncRNA/mRNA organized R-loops.

New Webinar

The Latest Highlights on
CircRNA in Cancer
Watch Video

New Brochure

Non-coding RNA and Epitranscriptomic
Solutions
Get Your Free eBook
Promotions

15% OFF Epitranscriptomic Array
Only 5ug total RNA is required Cover mRNA & LncRNA, or circRNA modifications
Valid 02/01/2024 - 5/31/2024

Request Quote


Meet Us at Tradeshows

AACR Annual Meeting 2024
Apr. 5 -10
Booth: # 2922
San Diego Convention Center
San Diego, California
 
 
Arraystar Inc. 9430 Key West Avenue #128 Rockville MD 20850 www.arraystar.com
Email: info@arraystar.com Phone: 888-416-6343; 240-314-0388