If you are unable to view this email in html format, please click here
 
 
Product & Service Selection Map | Publications |  Promo  
    Simultaneously Profile the Major Small RNA Classes
- miRNA, pre-miRNA, tRNA, tsRNA, and snoRNA

Arraystar Small RNA Array uses direct end-labeling and smart probe design microarray technologies to detect and quantify small RNAs including miRNA, pre-miRNA, tsRNAs, tRNAs, and snoRNAs simultaneously on the same array.

• Overcome biases from RNA modifications, PCR amplifications, and analysis inaccuracy in small RNA-seq
• Require as low as 100 ng total RNA, opening up new opportunities in tsRNA and tRNA biomarker research
• Tolerant lower qualities RNAs, such as degraded RNAs, serum/plasma/biofluid RNAs, and FFPE RNAs
Learn more>>

microRNA:
Mature-ID Mature-Sequence Seed High_Confidence Type
hsa-miR-188-5p CATCCCTTGCATGGTGGAGGG ATCCCTT Yes Mature

tsRNA:
tsRNA_type tsRNA-sequence tsRNA-length tsRNA-precursor Level Molecular mechanism
3'tiRNA ATTCAAAGGTTCCGGGTTCGAGTCCC… 39 tRNA-Arg-TCT-1 Potential Cytotoxicity to neurons

Pre-microRNA:
Precursor-Sequence GenomeLocus Promoter pri-miRNA pre-miRNA-cluster Mature-ID
CGGGGTGAGGTAA… chr22:46113686-46113768:+ p2@MIRLET7BHG, p4@MIR4763 NR_027033 let7a-3,let7b,4763 hsa-let-7b-5p

tRNA:
tRNA-Sequence Gene name GenomeLocus tRNA promoter locus pre-tRNA locus tRNA neighbouring gene
GGGGGTATAGCTC… tRNA-Ala-AGC-1-1 chr6:28795963-28796035:- chr6:28795963-28796135:- chr6:28795952-28796135:- XXbac-BPG308K3.5

snoRNA:
snoRNA-sequence Length Gene name snoDB_symbol Box type Host gene id Host gene symbol Target count Target summary
CCAACATGGATAG… 209 RNU105C RNU105C H/ACA / / 2 Others


Get Quote Now!

Subscribe to Our Newsletters!




Latest Publications

Yu Y Z, et al. (2022) Mol
    Cancer [PMID: 34986849]

Pan J, et al. (2022)
    J Exp Clini Cancer Res
    [PMID: 35012593]

Li Z X, et al. (2022)
    Cell Death Differ
    [PMID: 34999731]


Promotion

15% OFF Epitranscriptomic Array

• Get Your Epitranscriptomic Profiling
    Done in the Right Way!
• Only 5ug total RNA is required!

Valid 03/01/2022 - 6/30/2022

Request Quote


New Webinar

Raising the Bar of Multi-transcriptomic Profiling of Small RNAs
• Small RNA biotypes and functional mechanisms
• Biomarker uses of small RNAs
• Challenges of quantifying small RNAs
• Arraystar small RNA profiling technologies
• Roadmap to study small RNA expression

Watch Video

 
 
Arraystar Inc. 9430 Key West Avenue #128 Rockville MD 20850 www.arraystar.com
Email: info@arraystar.com Phone: 888-416-6343; 240-314-0388